CBrugiaQ_992


Sequence

>CBrugiaQ_992 (2 EST) Length=492 CAAGTCTATTAGACTCGGAGCGAAAAGTGGAAATTTTAGATGTGGATTCGTTCCGTTCAGACCCGTCAAATTTAACAGTG ATATTATATGAAGAAGATCATACTATTGGCAATTCACTGAAACATGTCTTGTGCAAAATGCGAGATGTTGAGTTCTGTGG TTACAATGTGCCCCATCCTTTGGAAGATAAAATCCTAATCCGTTTGCAAACGAAACGTGGAGTGTCAGCAGCCAGTATGC TTATGAAAGGTTTTGAAGAATTGGAATGTATTTTTGCTTCAATAAGGCAAAAATTTGATAGCTCTTATGCTTTATATACA ACGAATACTGAAGACTAGAATGGATTCAACTTGTCAGGAACGAAATCATGATTCTTTGCAAATAGGAATTGCTATTTCGT TGTGTGTTAGTTTTTCCTTGCTGTTATATGATCTCTTTGTTAGTTGCATAAAAGGAGTTGGTCATACAGAAATTTGTGCC GATTTTATTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_992: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001711737554AA161531MBAFCE9H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537652246979AA509102MBAFCX7C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:37:39 on Sat 18 Nov 117.