CBrugiaQ_995


Sequence

>CBrugiaQ_995 (2 EST) Length=511 GAAGGGAGGCGATACGTACNTCNAGGTGGAACACGATATTGGTATGCGGAGTTTTATGAATTACAGAAATTGCGAATTTC ATTGATTCATTGAGCAGTATGTCGGAGTACAGTGAAGTGGATTGGTGTGGGTGAGGAAAGAGAAGCACTGATCTCGTGAC CCTGAAGAGTGTCATATCAGCAATCATTCAGACTATATTTTATTTCTGAAACAAATCTCGAATCCTATAACCTATACCTA TAGGCCTTGAGATCTTGAAGTCTTAACGATTAATCCCCAATTCATATATATTTGATGCGATTACATTTGGGAATATTGTT AGTATTTGAAATCAACATCATTGTAGAACTTGCTAGTGTTGTCACATGCTGTATTGTTATTTGGAACGCATTATTATATT GTCCTTGTCATCTTCTGAAGTTTCATATGCTGCATGTGCATTATTTCCATATATTTAATTTTCATTATTGGCAGATGTTG CATGGTTAAATACAAACTTTCATTTTANNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_995: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427331164881N41283SW3ICA1017SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5931141397384W84927SWAMCA1080SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:49:56 on Mon 20 Nov 117.