CPlasFal_1004


Sequence

>CPlasFal_1004 (3 EST) Length=616 CTATTATTATCTGAAATATTCCAATGAAAAACTACAACCCTTTCAAAATGTAGACCTTTTTTATACAAATCGGATGTCCC AAGATTATCAATCCGATTGGGGAAATTATAATCTAAAACCTTTGTTAAATACATATGAAGCATATGTGCTCCTAAACTCA GTACCATATAAAGATATATACCCTATGGATTATTATTCACATAAAGGAAATATTTGGACAAATTATGCAGCTGGAGTGGG ATTTTATAATGAAAAAAATTTAACAACCAAAGAAATCATACTGTAGAAGAATTCAAATGAGGAAAAAGTAAAATTGCTAT ACCATTATCACCCAATGAAAAGCTATAAAAATCGGGTAATNTTNTAACAGNAATATATATATATATATATATATTACCAT AGCATTCATAATTTATTCAAGCTATACCTACTTGTNATCATTCAAAAAAAAAAAAAAAAAAAAAAAACCTTATTCCATTT TTTNTCATCCAAATGAACATTATGGATANCGAAATGGACACAAGGTGCATAANCGAAATCCGNNTGTTATCAGCAGANTT ACCATTNGAAGCAAAGAGTGGACATCAGGGGGCTCCAATAGGTNGGGCCCCTATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1004: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28657319393T095610163m3gmbPfHB3.1, G. Roman Reddy
28658319394T095620163m7gmbPfHB3.1, G. Roman Reddy
5048381675022N979882004C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:21:10 on Fri 17 Nov 117.