CPlasFal_1019


Sequence

>CPlasFal_1019 (2 EST) Length=564 GGTTTTTTTCTTTTTCTTCCCCTGTTTGATTTTTTCTTTATATTATCATTCTGTCCCTTTAGATATAGATCAGGTATATT TTTGTCCACTTTATCAAATATATTATTTACATTCTTTATCAAAAAAAACTGATTATTTTGTTTCACTACATTATCTATCA TTAAGGAATATAAAAATGATTTAAAATATGTTCCATTATTTTTATATTTTTTAACTTTCTTTTTTTTTATATATCCAGAT TGTTGTTCATGCCTATGTGCTTCATAATACAATATGACATCTTTCCTTTTCATAAATATTTCATCATACAAATTAAAGAT AATCATTTTATTAATATCGAATTCATTAGTGTTTATTATATCTTTTGTATTTTTTATCCATTTCATANAATATTTATATA TATCAAAGATATTTATTTTATATTTTTGTTTATAACTATAAAATAAATTGTGTAGCTTCACAAGGNAATGATAAAATGAG GNTTTGTTAGGTATGTTTCTATAATAACTTTTATTTCTTCCTTCTTTTTCAATAAAATGTACATTTCTTTGTGTATTTNC ATTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1019: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28835319571T097390338m7gmbPfHB3.1, G. Roman Reddy
11999022320144AA5498920965m3gmbPfHB3.1, G. Roman Reddy


Date: 17:14:35 on Thu 23 Nov 117.