CPlasFal_1040


Sequence

>CPlasFal_1040 (2 EST) Length=391 CACCTTAATAGTAATATTTTNAATAATAACGAAATGATAGATATGCGGAATTTTTATGAAAACGGTAATTTTGTTAACCC CATGATAGAAAATAAAGATCAAAATCAATTTAATGAACCGAATAAAAATAATTTGAATAATACTATGGCAAATGTTAATA ATATAAACAACATAAATAATATACAATTTGATAAAAGCCTATTAATTAATTGTATAGATGTCTTATTAAATTTTATGAAT TATAATAATTTAAAAGACACAATAACAGAAGAAACTCTTCATGAAAATTTAATCAATTTACGTTTTTATATTTTAAGATT AAATGGAGGAAAAGTTAGCCAAAAAAAAATTACTGAATATTTTCATAAAATGTAATTATATACATATATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1040: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28954319690T098580430m3gmbPfHB3.1, G. Roman Reddy
44134462881T180950494c3cbsPfHB3.1, Debopam Chakrabarti


Date: 6:34:44 on Thu 23 Nov 117.