CPlasFal_1045


Sequence

>CPlasFal_1045 (4 EST) Length=495 TAAACACTTTACCACTAGGGATAAGCCTCAACAGATCGTAAAACAAAGTTTACTTTCATGTTTACAGCACCCTGAGGCAA AAAAGTCGTCTACAGTTTGTGCAATTCTTTTTTGTTGTTAAAGAACTATTGCCTAGCTCACACAGCTCAAAGCTCACGAA ANAGGTGATAGGATTATTTATGTACCAAAAAAAGGCACATATATAATTTCTCTTTTACATTAGCAGTAAAAAAGGAAACA AAAAAGAACGAAATAGTATTGTTTAATCAGCATGGTTTCTGGCTTAAGAGGCGTTCAGCCATTATCCAACAGACTTAGCT TCGCAACACTGGTTTGTCAACCAATTGCTGTACCAATTGTCTGAACCAACTAATCCTCTCGTACCAAGTTGGATTACTGT CACAATACTATATGTATATATAAAAAATATAATAAAATTCATCAGTAGGGTAAAACTAACCTGTCTCTCGACGGTCTAAC CCCAGCTCACGTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1045: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045211674705N976871085C3czapPFDd2.1, Debopam Chakrabarti
5047681674952N979341564C3czapPFDd2.1, Debopam Chakrabarti
5048981675082N980482112C3czapPFDd2.1, Debopam Chakrabarti
5049621675146N980962174C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:7:35 on Mon 20 Nov 117.