CPlasFal_1046


Sequence

>CPlasFal_1046 (4 EST) Length=1008 TTATCCATTATTTTTTTCATTTGTGGATCAGTGTCATAATTTGGCATATATAGGTCACACTCGCGCAATAACCTGGAAGT TTGTGTATGGTGTGAGATGCTGTAATGGTTCCNTTGATTATATTCCAATATATTTAATGGNATAGCAAAAAATAATATAT TAATATAATGGACTTTCATTTTTATTGTGATATTTATATATTTATTTTTTTATGATTAAAATTATAACTAAAAAAATCAC ATAATATACTTTATTTTATTTTGTAAATAAATTAAATAAAAAATGTTTAACATAAAATATGATTATAATTTATTTAATAT AATTATACAATTATTTTCCCATTATATAAATATATANNNTTTTTTTTTTTTATAATGGAACCATATTTGCCTTTTTATTT AAAACCTTAAAAAAAAAAAAAAAAATTAAAAATATAATATATCAAAATATATTACATTTTTTATAATTTTGAATTTTAAT TTTTAATAAAATTTAATTTTATATCATACGATAAATTACAATTAAAAAGGTTTTTTTAATATTTTTCAAAAATACGTTAC GATTTAGTAAGAACTTCTATTTTTTTGTTGTAAAATATATACATATGTGTAAATTAATGGCTGTTGAACGTGTATACCAC ATATAATTTACAATTTGGAAAAACCTATTAGTGAAATTGATAATTGCAACATGTATGTTAACTATATTGCTGTCATATAA AAATCATTGCATATCATAATATTTGTTATTAAACGTAAAAAAAACAATATATATTTTTTAATAATAATNAATTAATACCA AATATATTTTAACAAAGTATTTATGTTGCCTTATCACAATATATATTCTTATTATCATCACAATCGTTCGTATCATACCA ATCACATTTATTATCCCCATTCATAAGATTATTCATATTTACATTGACATGTCCATTAACATATCCTTTATATGTCGCAT CATAATTTGTATCATCATTTGGGGAATACTCCTTAACACTCTCATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1046: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29070319806T099740533m3gmbPfHB3.1, G. Roman Reddy
29071319807T099750533m7gmbPfHB3.1, G. Roman Reddy
5045431674727N976931119C3czapPFDd2.1, Debopam Chakrabarti
12001922320434AA5501821298m3gmbPfHB3.1, G. Roman Reddy


Date: 9:28:54 on Sun 19 Nov 117.