CPlasFal_1059


Sequence

>CPlasFal_1059 (2 EST) Length=367 TAAAAACGAAAAGAAAAATAGAAGAAGAAAAAATAATAAGACGAAAGATGGCACGAGATTATTTTTTATAATAAAAAAAC AAAGTTGTCCATTGTTATATATTATTTTGTCCATATTATATATAACATATTGTATGGAATGTATTGTATGTATGAAATTA TCGAAGAATGACAATTGCTTAAATAGAAATAAATATTTTTTTCTTGAATATAAATTAAATAATGATTATTATGGAAAGAA AAGTTATGTAAATAATATAAGAAAACATATTTCAAAAAAAGATAATGTTATTAATAATCACAAAAATTTTAAATTAAAAA GTTCAAAGGTTGATGAAATTATAGAAAGTTTAAAAAATTTAACCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1059: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2754271427T025730210C3cbsPfHB3.1, Debopam Chakrabarti
5047331674917N978991472C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:32:10 on Sat 18 Nov 117.