CPlasFal_1094


Sequence

>CPlasFal_1094 (3 EST) Length=649 TTTATATCATCATTGAATTCAAAAAAAAAAAAAAAAAAAGGGTTACTTTTTTTTTATAACATAAAAATANGAATAAAAAA GGGAAAATGATAAAAAACATAACCAAAAACAAAATAATGTTGACGAAAATGAATTCCCCAATTCAAAGGTATTACTAGTA TCTGTAAAAAGGACCAGAAGATTTTTAGAAAGAACTGCTAGGGAATTATTAGCTGGAGGAACACGATATATTATATTAAG TGGATTAGGAGATGCATTACCTTTGTGTGTTCAATTACAATCATCATTACAATCAAAGAATGCAGCTAATGTTGTAAAAA TTGAAACATCATATNGTTATTTTAATTCTAACTATTCTTATACACCTGGTTTAAAAATATATATGGAAAAACATCCAGAA TTTAAAGGTTCTAGAATATCTCCAGGATATGTAAGTTTTCATGAGAAAACAGATAGCTTTACCCCTATTTATGATGAAAA CCCAAATGAATATATTTGTTCATTAAATGCTGGAGATAATAATTTATATGTTGGTGGTGAGGGTATTAACGGTGCCTTCT CAGAACTCTTGTCTTCACACAATCAGGAAGTTGATAAATATGAATCCTTATTTAAAGAATTTATTAACCCAAGGGCGGTT AACGGTAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1094: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2684267621T025030106C3cbsPfHB3.1, Debopam Chakrabarti
2698271371T025170125C3cbsPfHB3.1, Debopam Chakrabarti
5046131674797N977791246C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:14:45 on Thu 23 Nov 117.