CPlasFal_1104


Sequence

>CPlasFal_1104 (2 EST) Length=357 CCATTTATTTATTTTATTATTCTGATGTAAAATCGTTCATATTTTCAAAAAGATAGTTTGCAGCCATTTTCTTCATTTTT ATCACAAGCTATAAATGCTTCGAGTGCTACATGTTTTGGGAATCCTAATGATTCTAATTTTTTAATACTTTCCATTTCAT TTTCATTTAAAGGTGTAATAGGTATATTAATATTTCCATTATTAGGATCTGATAAAACTTGTGGTCCTACATCTTGTAGA AATGAATCATTTTGTATAGCATTTTCATCATCTGCAATTGTCCAGATTATCAACCTGAATGTTCCTCATGAGCCATTTAT ATTATTGCCATAATTTTGAAGNGCTGCTAAGAATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1104: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28660319396T095640164m7gmbPfHB3.1, G. Roman Reddy
5042111400072N973630356M7gmbPfHB3.1, G. Roman Reddy


Date: 1:18:58 on Tue 21 Nov 117.