CPlasFal_1105


Sequence

>CPlasFal_1105 (3 EST) Length=750 TATTAATTTTAATTAAAAAAAATTTTTATATAAGAATAATAAAAAAATGGCTAAAAAACCAGATCCGAATGAAATTAAAT ATGTTTTCATTAGACAAGTTGGTGGAGAAGTTGGAGCTTCTTCCGTGTTATCTCCAAAATTAGGTCCCTTAGGTTTATCA CCTAAAAAAGTTGGAGATGATATAGCTAAAGAAACACAATCCTGGAAAGGTTTGAAAATCTGTGTTAAGCTTACTATTCA AAACAGACAAGCAAAAGTTGAAGTTGTTCCTACCTCAGCAGCATTAATTTTGAAGGAATTAAATGAAGCTCCTAGAGATA GAAAGAAAGTGAAAAATATTAAACATAATGGTAATTTAAAATTAGAACAAGTATATTCAATAGCTAGAGTTATGAAAGAA AAATCAAGAGCTAAAGAATTTAAAGGAACTGTCAAAGAAATGTTAGGAACATGTAATTCTATTGGATGTACTGTTGATGG AAAAAAACCAACAACAATACAAGAAATGATCGACTCAGGAGAAATAGACGTNCCCCTTGAAGAAAATAAAAACAATATCG ACATATAAATATTAAAATAAAAAAAAAAATAAATATATATATATATATATATATATATATCATATACCTATTATTGTAAT AATATGAGTGAGAGGATGGATATGTACATTTACCATTTTAATGAATAAATAAATACAAAAATAGGTAANTACATACATAC ATACACATNTNTTTATATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1105: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045671674751N977331164C3czapPFDd2.1, Debopam Chakrabarti
5049161675100N978422134C3czapPFDd2.1, Debopam Chakrabarti
5049731675157N981072193C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:27:3 on Fri 24 Nov 117.