CPlasFal_1106


Sequence

>CPlasFal_1106 (3 EST) Length=668 GNTTAATGCGCAATGCNTGCCNTCCACCGTTGGTACATGTTTTGGGAGGATNCCTAATGGACNNTTATAATTTAAATATA CNAAATATTGATTAAAATTATGGACATATNAAAAATAATGNAAAGGAAATTTAAATATACAACAAAGATGTACTTGNTCA TGAATATCTACGTATTATAGGTTTGCAGACATTTTTCATTCTAATAATTGCAAGTTCCTTGATTTTAATGATACCCTTTA TTAGTAATATGTACTGGTNCACATTTGCTATGACTTTAGGTCTGACCTTTTTATTCTCAGCAATGGTAGGAAAAACTATT GAAANATATATATATATATATATATAANTATTTNTTTAACCTTGCTCGAATGCCTTAATCACTGCCAACCTTGTTGGGAC ATGAACGNTTTGATGAACTATTTTCCTCAATTCTCTATTTTCAGGTGTAAGAGCACATAAATTTTCCCATTCTAAATTAA CATCATAAACATAAAAATTATATTTATCATTATATACACATTCAGTCATAATTTGCATTATATTATATTCATCATATTGT GGGAATAATCCAGGGGCACATTCTCCACCATATTTTCCTTTGTAATATTTNATTTCCCCNTTAATATTTTGCACCTAGNC CAAAATACAGGTGGTANTCTATATTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1106: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2823319161T026410013M7gmbPfHB3.1, G. Roman Reddy
2886319223T027040059M7gmbPfHB3.1, G. Roman Reddy
2898319235T027160067M7gmbPfHB3.1, G. Roman Reddy


Date: 4:31:20 on Thu 23 Nov 117.