CPlasFal_1122


Sequence

>CPlasFal_1122 (2 EST) Length=648 CCATATGGTTGTTTGTAAGGGAAAGTTATATATAATGATAATGGAGGCCCCCAAAATATCCCCATATAGGTATTATNACA TTAGAAGATGTAANCGGAATATTATTACAAGGAGGAATTTCGGATGAATTTGATTTTAAGAAAATTAAAACGGGTTCTAG TATACCTTCTAATTTTGTTTGGAAAAATTCGGATGATTCAAAAAAAAAAATGAAAAGTAAAATAAGAAGNAGAAATCATA AGGTTGTTTTTGATGAAGACAATGTTAAAATGATAGAAGGGTTAGATGTGCATGCATCCCAAAATAAAATATCCCTAACA ACAACAACAAATAATAATAATAATAATAATAATATTTTATCAGGGATGTTGGATTTATCAAATGATTTATTAGATCATCA TTTGACAGGTGGTACAAGTAAAAAGAAATTAAACAAATTGAATCATATATCATCTAATCATGATTATATTAAAGTTGAAG ATAATATGANCTTTTTTATTGAACGACCAAAAAATGATAATATAGATACATTTAATACTGTAGATTTGTTACGATCAAGT TTAGCAGGNCANGCAGCTATTAACGTTTATAATANTGTAATGGCTTAGTANTAAACCAATCTTCTATAAANTGNCTCCNG GAATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1122: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2987319321T028050141M3gmbPfHB3.1, G. Roman Reddy
44153462900T181140662c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:26:7 on Sat 18 Nov 117.