CPlasFal_1131


Sequence

>CPlasFal_1131 (2 EST) Length=523 TTCCAAAGGGATTTTAATATNCCTATAACAATCTTCCCCATCTAATAAATCTATANCTTTCATAACTCTACATTTGTAAG ATTCATATAATTCTTTATTTTGNTCACATAATCGTAAAATATCAAAAGAAAAACTTCCTAAATGTTTTGTTGACAATTTT TTTACATCTAGTTGACTAGCCACAAAAGNGGACTTTCTTTTAAAATGATGTTGAAGAAAAATATTTTTCTTCCATACAAT TCTTAACATATTTTTATAAGTAAAAGGAGCACAGTTAANGGATCCATNGGTCGCATATTAAATTGCCATCCTCATCAAAA CAAAAAAAAAAAACAAAAAAAAAAAAAATATATAAAAGGTATACACAATTCATATATAGATAATGAAATTGTAAATAATA ATTATGATAATACTATTTATNCATATAATCAAAAAACTATTCCACTATTCACATTTGATGAAATACTTAATTTGGATAAC GTTTTCANTAAAGTGACTGAGAAACAACAGATTATTGAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1131: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28856319592T097600355m7gmbPfHB3.1, G. Roman Reddy
5046901674874N978561393C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:35:19 on Fri 24 Nov 117.