CPlasFal_1147


Sequence

>CPlasFal_1147 (2 EST) Length=366 AGGCCTTATAGCCAGNTTTGGTAATGCNCCCAATTTTTCTGATAATTCTTTTCCGATTTTANCNTTTAAGATAATTTTTT GTATATCTTTTTCACATTGTTCCTTACATTGTCTGTCGTTTAACTTGCATCCTTNCGTCATATTCACGTAAGTCGTTCAG ACGTTTGATCTATTGAAAATTTTCCATTAGTTCTTTCATTTCAGGGTCATTATCATAGATTAGATGGTGCAAATAATTCG CATTCGCATAATGTTCTATGTCTTTTTGTTGGTTTAGTTTTGGATGTACGAAGTATAGTTTTCTTAGGGTTCCTTTAATT ATGCACCTATAATCAAATGTTGACATATATAATGTATATTATAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1147: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28720319456T096240205m7gmbPfHB3.1, G. Roman Reddy
28787319523T096910280m7gmbPfHB3.1, G. Roman Reddy


Date: 13:25:31 on Wed 22 Nov 117.