CPlasFal_1149


Sequence

>CPlasFal_1149 (2 EST) Length=351 ATTGGCATATTTTGCTTATCACCGATTAGGTATTATATCTATGACGGCCTCTGGTTTTGATAGTTTAACAAGAGAGTTAT TAAATAATTTTGGAGGAGATGCGGTTATTATGCAATTGTTAGCTATATGTATAGACAACATAGCAATGTATTCTGTAGAG GTATATGATACAACGATTACTAGGGATATAATAAAATGTTTCAAGTCTGCTTTATCAAAAATGAATAATAAAAAAGAAGA TAAGCAATTATGGCAAAAGGTGGAACTTACTTTAGAAGCCATGAATTCGGCCGATGATCCATTGGTAGCATTTAAAAAAT ACTTTATTAATATTTGATNTTAATTTATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1149: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44193462940T181540734c3czapPFDd2.1, Debopam Chakrabarti
44206462953T181670765c3czapPFDd2.1, Debopam Chakrabarti


Date: 8:42:40 on Fri 24 Nov 117.