CPlasFal_1162


Sequence

>CPlasFal_1162 (5 EST) Length=979 TAAATATTTTATAAACTATGCCAGAATTANACTTAAAGAAATTACTAGTGATCTTTTAATAAAATATGAACGTGAGGCTT ATTTAAGTATGAAAAAATATGGTTATTTAGGTGAAGTTATTGCAGCTAGACTTTCTCCTAAAGATAAAATTATGAATTAT GTGCACGAAACTAACGAAGATATCATGAGTAATTTAAGAAGATATGATATGGNAAATGCTTTCAAAAACAAAATGTCAAC ATATGTAGATGATTTTCCTTTTTTTGATGATTGCGGAAAAAATGAACAATTTTTAAATGAGAGATGTGATTATTGTCCTG TAATTGAAGAAGGTCGGAGAAACCACAATTATTTACTACCACTGGTGATAAAAACACTAATAAGACCACGGAAATAAAAA AACAAACTAGTACATATATTGATACTGAAAAAATGAATGAAGCGGATTCTGCTGATAGCGACGATGAAAAGGATTCTGAT ACTCCTGACGATGAATTAATGATATCACGATTTCACTAATATAAAAATATAAAAAATATATATATATAATGTGGGTACAT AATAGCAATTCTAATATTTTCTAACTTGTTTTGCATTTATTTTCTTTTTTTTTTCTTTATCTTTATACATAATTATATAT TATGATTTAGAATTTGTTTGTTTATATTACATGTGTATAACTTTAATTAAGTATATGATTTGGTTGTTTCTTTCTTTACC TTTTCTTTTTTTCCTCTTTTTTCATTTTTTTTTTTTTGGATTTGTTTTTTTTTAATATTTGTTTTTTAATTTTTAGGAAA TTTGATTTGTTTGTTCGTAAAATAATTTATTTGTTTTTTTTGATAAAAATATTTTTTTAAATTTCATTATAATTTTTCAA TATAAATTCATATTTTTATGTAGAAAAAAAAAAAAAAAAAACTAAATTTAAGAACAAAAGAATATAAAATTAATTGAAAA GAAAATATTTTTTTCACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_1162: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44177462924T181380700c3czapPFDd2.1, Debopam Chakrabarti
44265463012T182260852c3czapPFDd2.1, Debopam Chakrabarti
44293463040T182540851c3czapPFDd2.1, Debopam Chakrabarti
5047081674892N978741430C3czapPFDd2.1, Debopam Chakrabarti
5049351675119N980692157C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:13:21 on Fri 17 Nov 117.