CPlasFal_1168


Sequence

>CPlasFal_1168 (2 EST) Length=566 AGATAGATTAGNTTNNNTCAATAGCGTTTTTAGTCATATCATTCTTATTAGATATAGTATCCATAGAATCATAAATTGCC GAGTTCATACTATTNGTTTTATTATNACAATAATGCATATCATCATTATTCATATGATCTAGTTGTNTTATGTCGTCGCT CCTCTCNCTAAATGACATGTNTTTCATATATTTATCGTCTATAATACCACTACTATTNTTAGCTACAATATATCCTATCG TATCCAACAATAATAACATTAGGGAATATTAGGAATGTCAATTCCGGTTGTGACTGGCAACTTGTAAGTACCAGGGACTC TCGGCTCAGCCAAACCCATGAATTAAAAGGGACAATAATAAGTATTACNAGATCCCTTTTTATAATCTTCACATCTTTTT GTTTTATANAANAGTGGATGATATAAAAANTCTTCAGTAGAATGAGCNCCAGGACATTCTCCTCCTCTTAAACATAAACT GTTAATAGAACCANCTCCCCTTGTTTCTACATCAGGACACATTACAGTAATGTAACGTATAAATGATGAGTCACNTAAAT AAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1168: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043151400176N974520910M3gmbPfHB3.1, G. Roman Reddy
5043161400177N974530910M7gmbPfHB3.1, G. Roman Reddy


Date: 6:45:40 on Sat 25 Nov 117.