CPlasFal_1182


Sequence

>CPlasFal_1182 (4 EST) Length=608 AAAAGATGCTACTCAGGATAAAAATTCAAGTGAAGATAATAATTGTAATTTTAGTGAAAACAATATAAGTAATAATGCTT CACCCATTAATGAAACACATAGTACAAAACTAAGAAACAAAAAACTAAAACAATCGTATTATCTAAATCCAATAGTTAAA AATGTCGACCAATGTATACATATTCATCCAGCCATGAAGGAAGTTGTTCAAGAAATGAAGACTATTATAAAGGAATCCAA TTTTCCCGTATTTGATCGTGTGTATAAAACAGGCATTTGGAGATTACTGGTTGTGCGTATGAACAGCAAGAACGAATTAA TGATTACTGTTCAAACATATACTCTTGATTATAAAAAAAAAAAAGAAATAAAAAAATTATTAATAAACAGGCTAAGTAAA AACAAAGATGATACACCTAAATATTTCTGTAACTTTAAAGTTATATCTATATATTTACAAGAACATGAAAATCCGAATGA TTCCTTTGATCAGTCCTTAAATGANCATTTATGGGGAATGGAATATTTAGAAGAAACCATTATTAGGCAATTAAATTTTT GTTAACTCCTTCCATGGTTTTTNCAAGTAAATCGTGNTAGTTGTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1182: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44092462839T180530417c3cbsPfHB3.1, Debopam Chakrabarti
44249462996T182100822c3czapPFDd2.1, Debopam Chakrabarti
44276463023T182370885c3czapPFDd2.1, Debopam Chakrabarti
5045501674734N977001135C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:43:50 on Tue 21 Nov 117.