CPlasFal_119


Sequence

>CPlasFal_119 (2 EST) Length=909 ATAATATCATCTTTCCCAGGCTCCAGTTTTCTATTTAATATATAATCAAAATTTATTTTATTTTCTTTTGACCATTTTTT ATAATCAATTTCTTCTATTTCTTCAAATGGCTAAAATATTATATAATGAATTTGGTTGAAATATATTTCTTGCATATCCA GTGAAAAACCATATACTTTTTTTTTCATTTAAATTTTTTAATTTCTCAATAATATTTTGATTACTTCCAAAAATGAATGA TCCTACTTTTTGTTTAATACCACTTAAAAATCCTACATTATTATTTTCTAATATGGAACCATACATATTATTCCTTCTAT TTTTTAATAAATCCTTCTTCTCACCTATTTTATTCTTTTTATATTTCATATCATTTTCCTTTTTTCTTTTTATAAACAAG TATTTCCTTCTTGTATAATATAATGAACCCTTACCATGAGGATATAATACATTCCTACAATTACTAAGAATGGTCCTTTT ATTTTTTTCTACATTATATGCAACACAAATTTTATTTACAGGGATAAAATATAAAATAAAAAAAATGTATATATATTCTC TCAAGTTCATAATTTATAAGGTATAACAACAATTGCATCTATCACACATTACATACATACATACATACATACATACATAC ATACATACATTTACATACATTACATACATACATATATAAATATTAATACATACATATATATTATATATATATATATATAT ATATATATATATATAATACATATTATATATATATATATGTAATATATTATTTATTTTTTCTCGATTTAGATTAATTTTTT TTTTTTTATAATTTAAAAAAAAAAGAAATTGTNCTTTTTGGGTAATAATTTTTTTTTCTTTTTTTGGGCTTTCCATTTTA TATAACAATAAATAAAAAATAATTGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_119: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049721675156N981062192C3czapPFDd2.1, Debopam Chakrabarti
12006452320887AA5506351824m3gmbPfHB3.1, G. Roman Reddy


Date: 7:21:38 on Sun 19 Nov 117.