CPlasFal_1191


Sequence

>CPlasFal_1191 (3 EST) Length=350 TTGTAGATATATATAAGATCAAGATGGAAGAAAAGAAAATGGATTATAAAATTGAACCGGAGAGAAAAGAAGCTGCTATA GATACANCTAACTGGCCTTTATTATTGAAGAATTATGATAAGTTAAATATACGTACATCTCATTTTACTCCTTTACCAAT GGGAAATTCTCCATATTCAAGAAATATAGAAGAATATTTAAAATATGGGATTATAAATTTNGATAAACCTAGTAATCCTT CATCTCATGAAGTGGTTTCATGGATAAGGNAAATTTTACGATGTGAAAAANCTGGTCATAGTGGTACATTAGTCCCTNAG GTGACAGGTGTTTTATTAGGTTTGTTTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1191: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041631400024N975270626M3gmbPfHB3.1, G. Roman Reddy
5041641400025N975280627M3gmbPfHB3.1, G. Roman Reddy
5041661400027N975300628M3gmbPfHB3.1, G. Roman Reddy


Date: 23:43:36 on Sat 18 Nov 117.