CPlasFal_12


Sequence

>CPlasFal_12 (2 EST) Length=759 ATATATTTATATTTATATTTATATTTATTTATTTATATACAGTCCTTTATAAATATTCTAATTTTCAATTACTATTTTTT ATGATTTCTTTTTTTATACGAATAACTGCTTCTTCTAGTACTTCATATTTTATCATGTAATTCTTTTGTTCTGCCAAAAA AAAAAAATAAATAAATTATATAACACACTTAATATAGATTATTTTAATAAGTAATACACACCTTTCTGTTAATTATAATG TTAACATATTACCATTTTTAATATTTAAAGACGGTATTTTATTAGGAACCAAACCAATTGATTTTTCTTTTCTTTGAATT TGTGCACATAAGCCAAAGTCTTTTATAACCTTTTCTAAACATTTCTCCGATATATTTAATATTTCCTGAACAGTGTCATA ATCAACAAACTTTTTATAATGTCTCCACTCATTTTCAGGTACTGAATATAAGGTAGCTTCTTCGTTACATCTATATTAAA TATAATGTTTTATATATAAATAATTAGTTATTCAAATATATACATGCATAAATACACTCACGCATATATTATCTAATAAT TAGATTCTTTATCTTTCTCTATTTTTATTAAGTATTGATTTTCAGAAATATTAATGGATACATACAAAACACATATATTT TTTTTCTTTTGTAATTTTTCTTTTTATTTTATATTTTACTTGAATAAATAATTACTTTCACCACCCATAACATAAAAGTT TTTATATGATCCATCTTTAATATCATGCTTCGAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_12: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001422320384AA5501321234m3gmbPfHB3.1, G. Roman Reddy
12001832320425AA5501731287m3gmbPfHB3.1, G. Roman Reddy


Date: 8:18:26 on Thu 23 Nov 117.