CPlasFal_1215


Sequence

>CPlasFal_1215 (3 EST) Length=537 AATATCCGGGAAGATTGGTTCANCTAATAGGATACCTTTTACCTCTGCCGGTTGTGAAAATCTAAANCCTTTACTTTCAT CATCATAACCAATGTGTTTTAATACGTCTCGTGTAACTTTGACATAATTTACCTTAGCCTTTGTAGTTATTCCTCCAAAT ATAAAAATATAATTCTTTTTAGCACATACTTCACATGCAACCTTGCTATATGGAACCTCACGTAAACAACTATCTAAAAT AGCATCAGATATCNGGTCACATATTTTATCTGGGTGNCCTTCATTCACTGATTCAGATGTGAATAAAAAGTTTCCTCTTT TAATTTTCAACTGACTCATTTTTTTTTTTTTTTTTTTTCACGGTATGCTAAAAATCTTTTGTTGTACTTTTAGATAATCA GGAAAAATANAATAAAAAAATAATTTTTATAAGATACAAAAATAAAAATAATTAATATATATGAAAGAAATGAAAAAAAG AGAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTCTCTCTCTCGNCNCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1215: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44231462978T181920799c3czapPFDd2.1, Debopam Chakrabarti
44269463016T182300863c3czapPFDd2.1, Debopam Chakrabarti
44278463025T182390888c3czapPFDd2.1, Debopam Chakrabarti


Date: 6:15:3 on Thu 23 Nov 117.