CPlasFal_1217


Sequence

>CPlasFal_1217 (2 EST) Length=349 CTACCTAAATAGTATACAATATAATAAAACTCTCACCTGTTGATATAAATTATGACACAAATGCAGTAACTATATATTTT ACTGATAATATTACTTATACTGTAAAAGTAAACTTAGAATATCTTGTATTTTTATTAGAAAAAATATCATTGATAACATT TGTAGAAGATTTATGTTCTCTCTTTGATACTGATAAAAAAAGAAATTATAAAAATTTAACTGAATTCTTAGAAAATACAG AACGTATAAATACATTTGTTAGAAATCATATGATGTTGTCTAATGAACAATTTATAAATAAAAATAAATATGCTAAGGAA TTAGCAGAAATATCTACATCTAATCTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1217: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048831675067N980332088C3czapPFDd2.1, Debopam Chakrabarti
5049651675149N980992178C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:4:48 on Thu 23 Nov 117.