CPlasFal_1234


Sequence

>CPlasFal_1234 (2 EST) Length=524 TATTATTACACTTGTTATTAGTATCACTATCATATGTATCATATATATTTGTTTCAGAATATATATTATTACAATCGTTA CTATTTATACCGTGGTATATCATTTTATCAAATTTCTCATATCTTGTATCCATTCTTTTTTCTTTACATAAATTATTATC AATTAGAGAATTATTATTTATATTCACCTCTCTNTTTATATATTTATNCTTCATAGAAGATTCATTCATTTTATCAAATG GATTAATATTACCATCCTTGGTCATATTACAATTAGTATCATTATTGTAACCATATATTTTTCTTCAAAAAATTAGTTTT AATAGCAAAATTTTCGAATTTTTCATTTTTTAGATTCTCTCTATCTTTATATTTCTCATTCATATGTAATCCATTATTAT CTCCNCAACGATCAATATTTTCCATTCCTTTTAATTTCCCTCTTTCCAATATATACTCTTCGTCTGAATCATCACTGCTG ATATTATAATCTAAGCTACTATCACTTAATTTAAAGTTGGTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1234: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28675319411T095790174m7gmbPfHB3.1, G. Roman Reddy
5046281674812N977941273C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:52:29 on Fri 17 Nov 117.