CPlasFal_1246


Sequence

>CPlasFal_1246 (2 EST) Length=347 TTACATATATATCACCCATCCGCGTGATTATGAACATTAACCTGTACATCAGGAAGAACGACCTCCTTATTCGTCAACTT ATCATATGCATATATGCTCAGAATAAAGGTTCTTGGTAATTCCCGTGCTTGAAACTTTTTATCGTTCTTAAATATATCAC AAAGGATATCATATAAATATTTATGGTTATACAGTTTAAATGAAGGGATATTAAACTTAGAATAAATAATTTTGTCCTGT ACACAAATTGTTTGAATATTTACATTAAAAACAATTTCGATTGGATTCTACTAATTCGTTTAATGTTATATTATTTGTAT ATGTATTCACATCCTAANTNNTTTNTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1246: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041591400020N975230621M7gmbPfHB3.1, G. Roman Reddy
5042491400110N974010632M7gmbPfHB3.1, G. Roman Reddy


Date: 13:9:36 on Sun 19 Nov 117.