CPlasFal_1268


Sequence

>CPlasFal_1268 (2 EST) Length=452 CTTTTTATGTGTTTTGTTTTTATATGTGATTATCATCTTTTAGAGGATTATGAAAAAAAGGAAAAACGATATTCAGAAGA TAGTCGTATAAATAATCATAAAGATATATCATATAAACATAATAACAATTATAAAAATAAAAATTCAGGATAGACCCCAG GTCCAGAAGTGTTTCTCCAGATATTAAAAGGAAGGAACATATTCCCGATCGTGGGATTGAAATAAAAAAGTATGATAGGT CAAGTAAATACGATGACAAATATGATAGGTCAAGTAAATACGATTGACAAATATGATAGGGTCAAGTAAATACGATTGGA AAATATGGATAGGGCAAAGTAAAATACGATTACAAATATGATAGATCAAATAAGTATGATGATAAATATGATAGGTCAAA TAAGTATGATGATAAATATGATAGATCAAATAAGTATGATGATAAATATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1268: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28628319364T095320146m3gmbPfHB3.1, G. Roman Reddy
28629319365T095330146m7gmbPfHB3.1, G. Roman Reddy


Date: 6:7:19 on Sun 19 Nov 117.