CPlasFal_1270


Sequence

>CPlasFal_1270 (3 EST) Length=379 CACTAGGTTTGTGGGTGAAGGTCCACCCTGGTGGACCATATAATTTTAACAATGGATTGGGTTGGCATACAGCTTCAAGA CCTTTTAATTTGTGTTTTAATGCTTCAGAATCAGCATTCGAGTTATTATTTAACCAATCTTCAGCATCTTTAACAGCTGA AAGGATAGTATTTTTATCTTCTTTTTCGATTTTATCAGCTAATTTATCTTTATCTTCAACAGTTGCTTTCATACTCTGTA TATAATTATCAAGGTTATTTTTGGCTTCAACTTTTTCTCTTAAGTTTTTATCTTCATCTGCGAATTTTTCTGCATCATTA ATCATTTTTTCGATTTGTTCTTTCGATAATCTACCTTTGTCATTAGTAATATCGTGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1270: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2756271429T025750212C3cbsPfHB3.1, Debopam Chakrabarti
44076462823T180370392c3cbsPfHB3.1, Debopam Chakrabarti
44089462836T180500414c3cbsPfHB3.1, Debopam Chakrabarti


Date: 14:19:48 on Mon 20 Nov 117.