CPlasFal_1284


Sequence

>CPlasFal_1284 (2 EST) Length=338 TAAGTCTTATCTACATATTTAAAATTGTTTAGCGAATTTCCATTTGTTTAAAATGGATAACCGACATATTTTGTAATGNA GCATTTGTATTTTTGTNTTCAATCTAAAAGAAAAAAAAACAAAAAAAAAAATAAAAGCAGAAAAAAAAAAACATTTCATT TTATTTATTTTATGACTAAATAAAAATATCAATGCTTTTGTTTTAGCTAGCTAGCCAAAAAAAAAGATNAAAAATAAATA AAATTAAAAATAAGGAAATAAAAGGAAATACACATATATAATTTATTCTATTAAAAAGAGGTGACACACACATATAAATC TAAATCTATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1284: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2882319219T027000055M3gmbPfHB3.1, G. Roman Reddy
2883319220T027010055M7gmbPfHB3.1, G. Roman Reddy


Date: 14:4:33 on Fri 17 Nov 117.