CPlasFal_13


Sequence

>CPlasFal_13 (4 EST) Length=852 GCTTATATTTTATATTTATTATGTTCCTTTTCAATCTTATTATATCTTGCATGTCTTCAAAAAAGTCATACAATTTCATA AAAATGTATCAATATTATTGCAATTTTTAATATATCTTAATATATGTAATACATATATTTTTCTACTTTTCTTTTAATAG ATATTTCCAAATAGATAGTTCCTTTTGTTTAACCGTTGCTCTTGTTTCCCTGACAATTTTCTTTGTATTAGTTTTATTTT TTTTAACAACTACAGCATTTTGTGACCCTGGAATGTACGATTAAAAAAATATATATATTTAATATACATATATATTCAAA CCATTTATTCATAATAAAAATAATATTAAAAAAAAAAAAATTTTTTTTTTTGACTCATTTTAGAATACCTAAAAGGAATT ATGTTGATTTATCATTGCCAAAAGGACGAAGTAAAAANTTAAAAAAAAAAGATTATAGTAAAAACAACTCTTTCTCTATG TCTAATTATATGCCACAATAAAATTAATTCAGATGGTACTATTCCAACTAACCCCATACCTGATGTACTTGCCCCTACTT TTATTGGACAATATGTTATGGAGGAGGATAAAATATTTCCATACATACCGGTAACAAAATAAAGTATGATAATCTTCATA ATACCATAATTCTTTTCTAATGTAAATCCCATTCTTAATTGAAAAAAAATATTAAAAATTGCATGGAATATATTTGCATG TAAAAATATGGGTAAAATCAATCTGTGAATTTCTCCCTGTTTTATTCTCGACGCAACATTCGCACCAAGGGTTACTAATA AGCTATCTACACAAATAATTAAATACATAAATAATTAAATAATTAATTAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_13: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041471400008N975110614M7gmbPfHB3.1, G. Roman Reddy
5042501400111N974020633M3gmbPfHB3.1, G. Roman Reddy
5042511400112N974030633M7gmbPfHB3.1, G. Roman Reddy
12001362320378AA5501261227m3gmbPfHB3.1, G. Roman Reddy


Date: 8:28:50 on Wed 22 Nov 117.