CPlasFal_1309


Sequence

>CPlasFal_1309 (2 EST) Length=398 ACATGTGANAAAATTGANGGCNAAAAATAGTTGCAGGNNCANTTATACCAGCACTTGCTACTACNACATCTATTATTACT GGATTGGTAGGTATTGNATTANTGAAATATGTAAACTATTATGATAATATACAAGCATATGTTAAATTATCAGATGAACA AAGGAAAAAAGAAAACGACACGNAATGTCTTATCCTATTTAAAAAATGCGTTCATAAATCCTCCTCTACCTTTATCCCTT TTTCCGGAGCCTATGCCTCCTTTAAGAATGATGGATAAGGAATATGATGAATTAATGAAGGGTCCGGTTAAGGCCATCCC TAATGGTTTTAGTTCATGGGNCAAGNTAGTCATATCGGTTAAAAAATTGGTACCTTTNAAAGGTTTTATNCGNTCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1309: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2654267589T024740005C3cbsPfHB3.1, Debopam Chakrabarti
28763319499T096670241m7gmbPfHB3.1, G. Roman Reddy


Date: 21:0:54 on Wed 22 Nov 117.