CPlasFal_131


Sequence

>CPlasFal_131 (2 EST) Length=944 GAATATGTTCTTATTACTATCTAATTGGTATGTTCCTTCTGAATTATTTTTATTAGTAATAGTATTGTGTACATTAATAT TATTATTATTATTATCATCATCATGGATTTTATTTTTGAAATAATTCATTTCCTTCTTTTCAATTATTTCATTTTTATTA CAAATTGTTACATAATTTTCTTCAGATATCTCATTTTCTCTTTTTTGAAAAAATTCTCCTTTTTCATAACTACTCTTTAG TGCTTCCATACTTTCGACATTTTTTGGACTGCCATCATTTTGTTCATTCTGTTGATACTTTTCATTTTCCATATTGTCCC CTTTAAGGGGAAGATNTATTTTTTCATCATGCTCTTTTTCTATCTCTACTGAAATAGCCTTTTTCATTTTATTCTTATCA GTAAATGATAAATTATGATCGTCATTCTTATTAACATCCTTTACATTCGTCATATTTTATAACATGCGAGTTTGTACTTT TGATGTATGTTCATTTATTTATTGAACATATTCATTCTTCTTCCGTTAAGATTTTTTTTCTTTTACTTTTTAAAAAAAGA AAGCAAAAAAAAAAAAAAAAAAAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAGGAAAGGAAAGGAAAGCTTTAT TAATAATGTTATCTTTTAAAAAATATTTAACATATGTCTTAACAATTAAAAAAAAAAAAAGAAAAAGAAATTCAAAAGTG TAATTTGGTATATCACAAAAATTGAAATACATTCATAAAATAAAATAAAATAAAATAAAAAAACTCGAGGGGGGGCCCGG TACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGC GTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_131: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049331675117N980672153C3czapPFDd2.1, Debopam Chakrabarti
12006542320896AA5506441833m3gmbPfHB3.1, G. Roman Reddy


Date: 2:54:47 on Mon 20 Nov 117.