CPlasFal_1314


Sequence

>CPlasFal_1314 (3 EST) Length=783 ACCGGTTATTTGAAGCAGGATTTAATTGAAGTCACACAACCTCGCTCAAAAAATTCTTTTTCAAAAGCTTGAAGTAGAAG AACTAGCCAAACAAAAAGCAAAGCAAGGAAAGGAAAAGGAAAAGGAAAAAGGAAAAGAGAAAGAAAAAGGAAAGGGAAAA AATGAAGAGACAAACTTGGATGCAAATGAGGAACAAAATAATGAAGCAAAAAATAATGAAGAAAAGGAGAACTCAACAAA AAATGGAAATTCAGCTAATCCAGAGGAATTAAAAATAATAAATCATAATAAATAAAAAAAAAAATAAACACATACATATA TATAGTTGTATTATTATATATAATATAAATACCTAAATAATATATTATAAAATACAATTTAAAAAATGGATTCACAAGAA TATATTCCACAATATAAATTAATCTTAGTCGGTGATGGTGGTGTTGGCAAAACATACCTTTGTGAAATAGACACTTGACT GGAGAATTTGAAAAAAAATATATACCTACTCTTGGTGTGGAAGTCCACCCCTTAAAATTTCAAACAAACTTTGGAAAAAC TCAATTTAACGTATGGGATACTGCAGGACAAGAAAAGTTTGGTGGTTTAAGAGATGGATATTATATAAAAAGTGATTGTC CTATAATTATGTTTGATGTATCTCCTCGTATTACTTACAAGACCGTTCCAAATTGGTATAGNGGTATTACAAGAGGTGTG TGAAACAAATTTCCNATGGGTTTTAGTTGGGAACAANGGTGATGTTAAAGGCAGGCCAAGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1314: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2990319324T028080143M3gmbPfHB3.1, G. Roman Reddy
28647319383T095510158m3gmbPfHB3.1, G. Roman Reddy
5047971674981N979471708C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:11:16 on Wed 22 Nov 117.