CPlasFal_1315


Sequence

>CPlasFal_1315 (2 EST) Length=514 ATAAAAGAAGAGTATTTTTAAAGTTTGAAAAAATATTCCTTTTATTTTATTTTATTTTATTTTTTGTTAAATGGCAATAT CAATATGTTGTTCTTTATATTATCTTAAGTAATATAAATAATTAATTAAATATATAATTAAATATAAATATGTGTATAAT TAAGTAACCGTATAAATAATTAAATTTGTATATTTGTGTATATCAAAACGTTTACTCCCTAGAGAATATATGCATAATTT TGTCATTTTTTTCTTGTCATTTTTTTTTCAATTAATTTATATTTTTTATTTAATTTATATATATTTCATTATTTATTTAT TTATTTATTATTATTTAATATACTAAAGAATCATTACAAAATATTCAATTCATGATTACAAAAAGGACATTGATTAANTA GAAAGANTTTTTTATAAAAAGAATTTTGCGTTGTTATAAAATTATAACAAAAAGAGCAGAAATAAATATAATCCAATTCA TATTGTAAATTGTATGATAAAATATGNNCATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1315: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042741400135N974260696M7gmbPfHB3.1, G. Roman Reddy
5046151674799N977811250C3czapPFDd2.1, Debopam Chakrabarti


Date: 3:56:6 on Sat 18 Nov 117.