CPlasFal_1329


Sequence

>CPlasFal_1329 (3 EST) Length=637 NAAAANATTGGNTTAAATTGGCCCAATTTTTAAGGGNGGGTTCCCATAAAGGTCACCTAGTTGTAGTTTTTCCTTTAAGA AAAGACTTCCGTGTGATAAAAATTTGATGTCATCTGGTGAGTACTCATTTAAAAAGGACAGTTTAAATTTTACATATTTC AAATTATATTCCTTCTTTATATCAATTAATATTTGAGATGCAGCAACAAATAAATCATGATAAGGAAAANCGTTTTTCAG CAATTCGATCGCTTTACCTAAGCAGTATGTCAATAAACCTAAAAAGGGTTATATAAAAGGGAATTAAAAAAAAAAAATAA TAATTAATTAATGCCATTATTATTTACATATGAATCTTCATTTATCGGTATTATTTATATTTTAAATGAAAAAATTTTGA AAAACTAACAATATTACTATAAGTAAAATATATAAAGTTTGTTTTGTTTGAGAATTCTTTACACAAAATACACCATCACC AAAATAAAGTTGTGAACACTGACATTTTACTGCACCTTCAACAATAGTACATTCTGCATTTACATCACAACCTCCATTAT TTTTTGAACAGTTCATATCTTTCATAGGTATACATTTAAAATAATTTACACTCATATCAACTATATAATTAGGTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1329: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2876319213T026940050M3gmbPfHB3.1, G. Roman Reddy
5046161674800N977821251C3czapPFDd2.1, Debopam Chakrabarti
5046211674805N977871260C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:4:58 on Tue 21 Nov 117.