CPlasFal_1332


Sequence

>CPlasFal_1332 (3 EST) Length=536 CACGAGCGGCACGAGATTTTCCTTTTTTTTGTTATTCTTCGTATATAAAAATACAAACACTGTAGTTTGTNATAACGGAT ATGGAGATTTAGCAGCAACAAGTGCCTTAACCACCGTTATTAAAGATCCAATTAGTTTAACAATTAAAGATATTTATGAA CACGGAGTAAAAAACCCATTTACAAAAATCATCCATAAATTAAAGAAATTTATACGTTATAGAAAAGTATTAAGATGGTC ACGTATGTGGGTGGGTATTGTTAGTAAGAGAAATTGTTGGAGGTAACACCATCGNAAAAAAAACAGAAAAGGCCTTGAGN GAAATATGGGATCAATGTACCATCNGCTGTTTACAACAACACATTAAATGCCGGAGAATCCAAACCATTATTATTTTGAC ACGGTATATTAAATGAATGCAGAAACAACGTTTGCCACAAAATTAAGACAAGATCCAAGTTTAATAGTAGCTAAAATTGA TCAAATAATAAAATCACAAATATATAGNTTCTGGGTNTCAGACCCATNCTTNAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CPlasFal_1332: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2667267605T024870076C3cbsPfHB3.1, Debopam Chakrabarti
2759271432T025780221C3cbsPfHB3.1, Debopam Chakrabarti
5045221674706N981491086C3czapPFDd2.1, Debopam Chakrabarti


Date: 7:27:44 on Sat 18 Nov 117.