CPlasFal_1346


Sequence

>CPlasFal_1346 (4 EST) Length=551 GAGTGTGTGTATGTGCTTCTGTTTATTATTTTCCTTTTTCTTTTAAATTTAGAAACATTTTCTGTGGACAATACTTGGTC CTGATTCATCGTATTCCTCTTTTGTGATCCACATTTGTTGAAAGGTAGAAAGAGATGATAAGATAGAACCTCCTATCCAG ACTGAGTATTTTCTCTCTGGTGGTGCAACAACTTTAATTTTCATGGTTGATGGTGCAAGGGTTGTAATATCTCTAGTTAA TCTTTCTCCTATACCTTCATACATAGTAGTACCTCCAGATAAAACGATATTTCCATAAAGATCTTTACGAATATCCACAT CACATTTTTTAATAGAGTTGAAAGTAGTTGTGTGGATTCCTGCTGCTTCTTTTCCTAAGAAGGATGGTTGGAATAAAGCT TCTGGACATCTAAATCTTTCATTACCTACAGTAATAATATTTCCATCTGGTAATTCATATGATTTTTCAATATCACTGCT TTGTTCAGATGTTTTCATTTCTTCATCAAAATTTAATGCAATATAACATAATTTCTCTTTAATCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1346: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2808271481T026270286C3cbsPfHB3.1, Debopam Chakrabarti
5046461674830N978121306C3czapPFDd2.1, Debopam Chakrabarti
5046721674856N978221349C3czapPFDd2.1, Debopam Chakrabarti
5048171675001N979671729C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:21:11 on Wed 22 Nov 117.