CPlasFal_1370


Sequence

>CPlasFal_1370 (4 EST) Length=911 AATGGAAGTGGGACCGTTCAATTAATCAGTTNNCATGACAATGTGTTAATAATTCATCNTTTGTCATATTTTTTAAAACT AAAGCATTCATAATAATATCTTTTATAAGATCTGATTTTTTCTTATGTTGAGAGGTTTGTCCTAGGTTTACTTGATCAAA ATCTATTCTACCACTTAATGGATCAATTAAACTTTGGAAGGTAGCTATATTCATCAATCTGACAGCTTCGTTTGCTTCTT CTGGTGATACTACACGCTTTAATTTCATTTTTGCTAAGCTTTGACTTAATCTTACTAATCCTTCTAGTTGTCTTGGACTA GCTGTTGGGAGANTTTGGGTACCCTTCTTTACATCTCAGTTTTATATATTCTTCAATGATAATTTTTTTACTTTCAAGTG AGATGATAGGATTACATGTTATACGACAAATAAAGCTATATATAATGCTAATGTATTAGAATCAATTAAATAATTCTTAG ACGTTTTTTTATTAGAACTATTATTATATTCATCATATGATATATTTACATTAGCCCAACTGCCTCTTTTATTTTGTGCA TCATTACTATCATTAAGGTAATTACTTATATCATCATCATCATCATTATCACCATCGTTATAATAATTTTCACGTTCATT TTTTCTACTTGTTCCTCGTGACTTCCTAGCTCTCTGTTGTGTAATATAGTTAGGTTCATCTTCTTCTTGTCTTCTTGATC CTCGTCTTCTTCCTCCTCTGGATTGTAGGAAAAATTTTTACAGAGNACAGTGGCTAGTTTTCTGTCTTCGTCTTCGTTGG CTTGATCTATAACTAAATAAATTAAATCAAATCTAGAAAATAAGGAAGGTGGTAAATTAATATTTTCAACAACTGCTTTA TTTTTATCATATCTACTATTAATAGGGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1370: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2726271399T025450159C3cbsPfHB3.1, Debopam Chakrabarti
28677319413T095810176m3gmbPfHB3.1, G. Roman Reddy
44066462813T180270381c3cbsPfHB3.1, Debopam Chakrabarti
5046591674843N975851328C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:37:35 on Fri 17 Nov 117.