CPlasFal_1378


Sequence

>CPlasFal_1378 (2 EST) Length=548 CAGGCATTAAGGATGATGCTGTAGATCCCAAAGAGTTCACATCAATGGTTCAGTTATCTCTACTAAAACAATTACAACTC ATCCATTTTTCAGGTATGTTATTGGTGCACATATACACATTCAAGTATGAGCATATAGGTAGGTACATAGAGACAGACAT ACACTGAAAAAAATCATTTNTGGNTAATGGGCATAACTCTACAGAATACTTAATGTTCTAAAGGCCAAATAAAGAAAAAA AAATCTGGGAAACACTTCCCAGAAGACTGGCATCTATAACAGGTAGGTTCCAAAGCAACCATTTTTTTGCTATTTTAAGG ATGCCCTCATAAGGANAATAAAGAGGAGAAATTATCTCTAAAANACCACATAAAAGAATTCTAGAACTACAGCATATAAT TAAGGTGCCCTAAGGGGACACTATCCAGATTGACTGTGATTTGTAGAGGTTATATGGTACATAATATATCTGTAAAATAT AATGCTAATGAGACTTAACATTTTAAANATAAACNGAAAAATATGAGCCTTCAGATTGTATTATAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1378: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28779319515T096830270m3gmbPfHB3.1, G. Roman Reddy
28780319516T096840270m7gmbPfHB3.1, G. Roman Reddy


Date: 6:13:50 on Fri 24 Nov 117.