CPlasFal_1383


Sequence

>CPlasFal_1383 (2 EST) Length=326 CCATTATGTTATAATTCTTTTTCTTCTTTTCAGTTATGATCATATATAAAATGAGGGGGAATTATTACTAACCATCAAAA CAAACACATTTACACACATAAATAAATCAATTAAAGGAAAGGTATATCTTTCAAATGTTATCATTTTCTAATTTTTTTTT TGTTAAGGACAAGAACAAACATCAAGGTACAATAAAATTATGATGATCATTTCATTTATTTTATTCTTTTAATCTTTTTC ATTATATTACCAATACCATTATCAGTGTAAAAAAAAAAAAAAAAAACACACATACATACATACATTCAAGCTTATCGNTA CCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1383: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29081319817T099850542m3gmbPfHB3.1, G. Roman Reddy
29082319818T099860542m7gmbPfHB3.1, G. Roman Reddy


Date: 12:44:46 on Fri 17 Nov 117.