CPlasFal_1393


Sequence

>CPlasFal_1393 (2 EST) Length=326 TGTGTGCAATATTTAAATAATATTATAGTATAATTTTTATGAGGTATATAAAAAGAAATACAAGGTGCAGTACATACCAA GTACCAGAAGTTATAGAGCACTAAACGAAATTGAGGATCTTCGAGATACTAAAAAACCTCATGTAAAAATAATATTACTT AGTGAAGAAGATAAAAAAAATGATGAAAAAGAAAAGATTAAAGAAATTATAAGGCATTATAGGAATAAATTAGACAACGG TAGTAAAAAGAAAAATGTACAAGAATGTTAACAATCATTATTTTAGAAAGGGAAAATTTAAATAAAACCCTAATGTAAAT NAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1393: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28708319444T096120199m7gmbPfHB3.1, G. Roman Reddy
44151462898T181120660c3czapPFDd2.1, Debopam Chakrabarti


Date: 16:33:9 on Fri 17 Nov 117.