CPlasFal_1397


Sequence

>CPlasFal_1397 (2 EST) Length=323 ATAGTAATAGTAATAATAATAGTAGTAATAGTAATAATAATAATGATATGACGGTGTTATTGAATAACATGAATGATGTA AGGATCAATCCAAACGTTTTATTAAATAATAATAATTTATTTTTTCAAGGTAATAATTATAAGAAGGATGAATCAAATAC TGGGAATAAAATGAGCAAGGATATGAATGTTATTAATAATGCGCACGCGAATGTTGAAATAATGAAAAATGATAACATGA GCAATAATAACAGCAGTAATAATAATTTTGTTGTAGGTAGAGATTTGAAGGATATAAAAACTCTTAATAAAATATTATTG TTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1397: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28918319654T098220405m3gmbPfHB3.1, G. Roman Reddy
28919319655T098230405m7gmbPfHB3.1, G. Roman Reddy


Date: 21:50:36 on Mon 20 Nov 117.