CPlasFal_1410


Sequence

>CPlasFal_1410 (2 EST) Length=330 AGTTTCTTTTAATTTAGTGGAGAAANGAANTNATCTATCAGTACATGTTTTATAGCTTTTACAGATGGCTAGTTATTTTT TTTTCCCCTTCTGAGGGNCAAATAAGTTTTTTAATTATTTCCNTTTTCCATATAAAAAATATATATTTATATACATTTCA GTTTTAATAAAAGTTTATAAAACTTAAGAATTTATTTTTGTTTTTTCCGTTTTTAGTATTATATCAAAATATCACCTTGT AAATGGGATGACAAACATTATGTGTGTTGTTGTATACTGATATATAATAATGGGGTCATGCAGGTATTGAAATACACTTN AAAATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1410: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28607319343T095110105m3gmbPfHB3.1, G. Roman Reddy
28608319344T095120105m7gmbPfHB3.1, G. Roman Reddy


Date: 11:33:14 on Wed 22 Nov 117.