CPlasFal_1447


Sequence

>CPlasFal_1447 (2 EST) Length=411 ATAGATATTTCTACTTTTTTTTTTTTTTTTTCTTTACCTTATTATAAAAAAATAAAATAAAAAAATATAAATAAAGTGAG AAAGAAAAATGATAAATAAATAAATAAATATAAATATATATATATATATATATATATATAAATATATGTATATATGTATG TTTATATATTTATTTATAATATTTTGNATTTGAACTNATGAATATAAAATAATAATATAATATATATATAAATATACATT ATATTTTATGTTTCATTTTTAAATTCCAGCGTAAATAATATATATATATATATATATATATTAATACAATACCATACATT ATAAACGTTTATCTTATTTTACTCATTATTATTCTATATTCTTCATATAAAACATGGTGAAATTCTTCAACGTCCCGTGA AAATATTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1447: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044011674585N975510421C3czapPFDd2.1, Debopam Chakrabarti
5046521674836N975781315C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:37:1 on Mon 20 Nov 117.