CPlasFal_1455


Sequence

>CPlasFal_1455 (2 EST) Length=313 TTATATCTTGATATTTTTTTTTTTTTTTTTTTTTTTTTTCCTTTTACGTATAGTATTATTATCTCATCGCTACATAAGTT AATTAAAATAATATAATTATTTGTGAGGACTAATAAAGTTTCAAGAAAAACCTCTGAGCGAATTATATTTTGCTCACTTA TGGTATTTATGTGAACATTAAATTTTGTATTATAATAAAATTGAATTAATGTATTTATATTTAATTAATGGGAAATTACA TTTTGACCTGCCTAATTAATTTAATAAATATATCCATTTTCTAAGGTCACAAATAAAGTTTGATTGTTCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1455: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28627319363T095310145m7gmbPfHB3.1, G. Roman Reddy
28641319377T095450152m7gmbPfHB3.1, G. Roman Reddy


Date: 10:5:29 on Wed 22 Nov 117.