CPlasFal_148


Sequence

>CPlasFal_148 (2 EST) Length=994 TTCATGATCAACATAATCATTGATATAAATTTTTTTTCGACTCTGCTCACTTGTATGTAATTTAAAATTTTTTCATTTTT AAGCATTTCGTCCTTTAATATATGATTTACATCAATAATATGGTTATTCTTATTATCACCATTGTTATTATTATTGTTAT TATTATGGTTGTTATTATTATTATTGTTATTATTATGGTGGTTATTATTATTATTGTTATTATTATTATTGTTGTTATGG TTGCATATATTATGCTCGTTCCTTTCTATGGTATCACTATTTTTTTTTTTTTTTTCTTTTACATTAACAACATTATTCTT ATCAAAATTTTCAACAGAACAAATATTATTTTTCGAAGAAACTCTTTTATCTTTCAAATGAAGGTTATCATTTTGATCAG AGTACTTTTCTATTTTTTTTGCAACATTTATCAATTGTCTTATATCCCTCTTTCTACCATATTTCTTTCCTTTTCTCAAA CCTGTTGCATATTTATTTGCCCATGTGTGTATAAATTTTTTTAAATTTTTCACCTGAACGTCAGGTAACTCACCATTTAG CACATTTTCCGTTTTGGCTAGTTTTTTTAAAAAATTGCTAGCGAATTTAATATTATTAATATTGTTGTTATTATTAATCA TTATTGTTATTATCAACATTGTTGTTGTTATTCATATTATTATTATGATTTGTAACAGTTGTAATATTAGGGGGTATCAT AGGTATATAAGGTAAATTTACTAAAGTGTTTGAAATGTTTTGTGCAGGCATGTTTTTTGAAATATTATTAGATGATTGAT AATTATTTGATACATTATTTGCTCGTAATTCTCCTAATATGTTTTTATAACTTAAATTTTGATAACAATCAAATTTAGAT GGACTAAGTGTACAATCCTCTGTCGTTGAACATCTAAGTATATTACCCATGAAGGTATTAAGGCCAACCGGATTAGCCTC TTCTTTTCTCTATAAAAAAAGGGTACAAACATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_148: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003372320579AA5503271468m3gmbPfHB3.1, G. Roman Reddy
12004282320670AA5504181569m3gmbPfHB3.1, G. Roman Reddy


Date: 6:34:58 on Tue 16 Jan 118.