CPlasFal_1488


Sequence

>CPlasFal_1488 (3 EST) Length=646 TTATTAAACATNCCAACATAATCAATNCCANGTTTTACATCATATATATTACTAGAATTNTCATATTTNCCTTCCAATGT AAAATTTTTCAACATATGATCATTTACTATATCATAACATTTATCTGAACCATTATTATTATTCACATTTTCTTCAGATT TTTTATTATTATTTATTATATAAATATTTGTCCCANCGTTTTGCACTTGATTATTTAGTAATAGACTGTTATATTTTTCA TCATGGTCGTAATTAGCACACTTAATATTAATATTATCATTATTATTAATATTATCATTATTAATTTAATTTTTTNCCTT TTNATCGTGCTCACCCTGTGTAGTTATAATAAAGTGCTTATAAAAATAATTGANAGAATTTTNAAAGTTTTNAATTTTNA AAAAAAAATTGGGTAACTTATGAGAACACAAATGTTCATAATTTTGGACACATGAAGATACACATGTCTGATTAGAAAAA ACAACAATTTCATATTCCTTTTTTTTTAAAGAATTTAATATGGGTATCCTTCCTTTATCAAATATTATATTANCCTAATG GTTATTAGNAAAATGTTTATTTATTAAGGTACCATNAAAATCGAACGAGGCAATTTTTAAAGATTTTCTTAAAAGGAAAT TTATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1488: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28621319357T095250123m3gmbPfHB3.1, G. Roman Reddy
28622319358T095260123m7gmbPfHB3.1, G. Roman Reddy
28927319663T098310410m7gmbPfHB3.1, G. Roman Reddy


Date: 10:0:42 on Wed 22 Nov 117.