CPlasFal_149


Sequence

>CPlasFal_149 (2 EST) Length=849 CCCCTGTTACCATTTATCATTAAATTTTTTATATCATGTGCATCTCTCCCAATGAAATTATTTTCCAACTTTTCTTCTTG GATGGAAAATAAAAAAAAAAGTAATAATAGTACAAAGCAAAATAAAAATTATTTTCAAAGGAAATATGAAAATTTCAAAA AAAAGAGAACAAATATGAAGAAAAATAAATGTACATCATCTTCCGTCTCTTCTTTAACAAATGTTTCAAGTATTTCTTCA AATAATACAATGAACAGTGATATAAAAAAGGACGTATCATTTAATAGGATTAAATCAAATAGGTACAATAAGGAGAATCA TAAAAACAAAAAGAGGAAAACAAAAGGTAACCATAGTAAATATAGTGGTACCTCGATGGAGAGTACACTAACAAATACAA GTCCCTCAAGTACACCTGATAATTTAAGTGAATCTCATATAACATCTAATTCAAACAAAAATAATTATTCATCAAAAAAA AAAAACAAGTGTAATATGCTATATAAAAAAGAACATTCCAGGAAAAGTATAAGAAAAAAATCTATGGGGATATCTGAATA TTCTTCTTAAGAATTACATAAGAGAGAAAAAAAATTAATGAACATGATACAGTCATATATATATATATATATATATATAT ATATATATATCTATGATCATTTTAGACTATTTTTTAAACAAGGACGTTGTTCAAAAGTTCATTTTTTATTTTCTTTATTC ACTTGTATTATTTTATATACCAAGGTGACTATAAATTTTTCTGAATTATTACACATTGTCCACATATACATAATTGTATG TTTAAATATGATGGTATATGTTTGATACGTCCCTCTGATTAATATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_149: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44090462837T180510415c3cbsPfHB3.1, Debopam Chakrabarti
12005222320764AA5505121669m3gmbPfHB3.1, G. Roman Reddy


Date: 9:48:48 on Fri 24 Nov 117.