CPlasFal_1492


Sequence

>CPlasFal_1492 (2 EST) Length=391 ATGGAAACAAAAATATGTCTTTTAATTTTTATAATTTTTATATTTTATTTTTTTTTGTTGAATTTATTTTTTACAAAATT TTTAAGCATATCAAAAAAAAAAAAAAAATTAATGAATAATAAAAAAATGAATAAATTATAAAAATATATAAATTATAAAA ATATATAAATTATAAAAATAAATAAATAATAATAATAATTATTATTATTATTATCACATATTAAACAAATACATTTATTA ATTTTTTTTTTTTTTTTTTTCAATTTATTTTATTTTATTTTTTTATAATTTAAATAACATGTTTTATTGTTTTTTTTTTT TAAAATTTATTATCAAATGAATAATAACTTTTAAAATGTAAATAACAATTTTTATATATTATGTAAATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_1492: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049191675103N978452137C3czapPFDd2.1, Debopam Chakrabarti
5049851675169N981192211C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:7:57 on Fri 17 Nov 117.