CPlasFal_150


Sequence

>CPlasFal_150 (2 EST) Length=898 AACACCAGATAAATAAAATTTGATTACAAGTTTGGATGCTTCTGTTTTTCCTGATCCACTTTCTCCACTTATAATTATTG ACTGACTATTTTTTGTATTTATAAAATCAAGCATTGCATCCTTTGCATATGTATACACGTGAGGTGGTAATAAATCTGTG CTCTTATTCTTATACTCANTCATATCAGTATCAATTACTTGATAAGGATTTACCGATATTAGCATTGGCTCAGCTATAGT ATATATATAATTCTTTTCATATCTTAAAGCTAAAGTGTTTAATACCTCTGCTGAGTTTTGATGAACCATATCATTTAATC GATGACTATTTATATTTACCATATTATTGCAATTAAATAAATGTTCCTTTTTCACCGTATATACACTGTTAGTTTCAGGA GATATTTCTTTTACCTCATAATTATCTCCATTTATATTAAGAACTTGACATTTAAAAAAAACCAAATCAGGATATAGATC AACATTTGGACTTTTATATGTCCACACATAAAAATTTTCACTTTCATTTTCACTTTTATTTATAAATGTACTATTAATCC TGAAATAATTATTTAATTCGTTGATTTTATTCACCATTATTATATATTTTATTTATTAATAGTATATATTATATATATAT ATATATAAATATAATTAGGGGTCGTCTTTACCAAAAGGGACATTGATTTAATTCTTCATGCGTGCAAATATCACATTCAA GACAGAAGATATTAATCCCATTTTGTACATTGGTATATTTTGTTATACATTGTTGGTTACATGATGAACATACTTTATAA TGCCCTTGTTCATTTTTAATTTCTATAAATAAAGGGAACCTTGTAGTTTATTTGTAATGTGTGAATGATCGTGCATCGTT ATTAATTGTATACCACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_150: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28637319373T095410150m7gmbPfHB3.1, G. Roman Reddy
12003812320623AA5503711517m3gmbPfHB3.1, G. Roman Reddy


Date: 4:21:59 on Wed 22 Nov 117.